Puzzle 3 - Intermediate - Neisseria
Difficulty:
Today's isolate sequence is from Neisseria gonorrhoeae.
Gene NEIS1072: Isolate 50488.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
As there is not stop codon something has changed at the end of the gene. As there are no additional stop codons, it may only be a small change.
Zooniverse users identified a possible stop codon at site 519 (TGA). This is site 469 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is NEIS1072. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
GTGCTGAACAATGAACCCGGCGGACTGACCAATGTCGAACAAGGCGAAAGCGTTTGCGTTCCGGTTGGCGACATCAGCGACTGGATGTTCGTGTGCAACGGCATCCCCTACGGCGGCTTTACCGTACAGGCAATGCGCGGACAGATGACGGAAGAGGAGCGTACCGAACACGATACCGCCTGGGGAATCGATTTCGGCGATCCCGGGCAGGTATTGCCGGTGTATGAAGAAAAAGAACATCCCGAAAATTTGGAAGAGCATCCGATGTGCCGGAACTGTATTGACGATTTTCGGCAACAGTTGTCCCAAAATCCGGATTTTCTGCATGAGCAGGACGAAGACGGCTATACGCCGCTTCATCATGAAGCCATGGCAGGAAATGCACTTATGGTTCAAGCCATGCTTGAATACGGCGCAAATCCTGCCTCAAAGACATCGGAAGGCTATACCGCCTCGATTTTGCCCGCCTGACGGGCTGGCAAAATGTTGCCGACCTGCTCGAACCGCGACATTAG |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Focus on the possible stop codon suggested by Zooniverse users. Why was the yellow sequence was predicted longer than this?
What has happened?
Looking at the possible stop codon, shown by the black arrow, we can see that the isolate sequence is shifted by one to the left. By looking further upstream we can identify this has occurred due to the loss of one C base at site 454 shown by the black circle. You can see that the sequence for a stop codon is still at the end of the gene, but out of frame. We call this a frameshift mutation caused by a single base deletion.
What does this mean for a bacterium?
In a bacterium, the protein machinery would terminate once it reaches the stop codon identified by Zooniverse users. As this is near the end of the gene, it's possible it could be a partially functional protein. In vivo studies would be required to test this.
What would a curator do?
A curator would create a new allele up to the stop codon identified.
