Puzzle 4 - Intermediate - Campylobacter
Difficulty:
Today's isolate sequence is from Campylobacter.
Gene CAMP0593: Isolate 80415.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
Something has changed towards the end of the gene as there is not a highlighted stop codon. Additional stop codons within the gene hint that a major change has occurred - i.e. a frameshift. Zooniverse users identified a possible stop codon at site 843, 793 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is CAMP0593. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGCAAAATATTTTATCTTCTTTTGCTCAAGAAAAAAATGTTTGTGTATTTGCAAATACTTTAAAAACTAGCATTGAAGAATTAGAAAAAGAATTTTTAAAACAAAATTTAAAATTTAAAAAGATCAATGTTTATTGTTATTTGTTTGATGCCAAAGATAAGGCTATCTTAAGTTCTATGAAAGCTTTTAATGAGGCGCACTTTTATATACAAAATTATTCTTCTTATTTGTGTGCTTTAAATTTAGAGGTCAAAGCAGGGCAAAGTGTTCTTGATATGTGTGCAGCTCCGGGTGGCAAAAGTATCAATCTTGCAAATTTTATGCAAAATACAGGTTATTTAGCTTGTAATGAGATAAGTAGGGATAGATTTTTTATTTTGCAAAAAAATCTTAAAAATTACGGCGTGAATGCTAAAGTTTTTATGAAAGATGGTAAAAATATAGGCAATTTATGCCCTTTAAAATTTGATAAAATCTTACTTGATGCACCTTGTTCAACTTTTGCTAAAATAGGTTTTGATTTGGAAAAAAGTTATAAAGAAATCAAAAATATTGCAAAAACTCAAAAAAACTTCTACATTCTGCTTTAAAGGCATTAAAAATAGGCGGAGAGCTTGTATATAGTACTTGCACCTTTACCAAGGAAGAAAATGAAGAAGTGATAGAGAATGCTTTAAAAAGCGAGTTTAAATTAGAGCTTTTAGATATTGATTTGGAAAATGTTGAGGCTAAAGCAGGGCAAAGTGAAGAATTTGCTGAAATTTCAAAATGCAGACGGATTTTACCAAGCTTAGACTATGATGGATTTTTTATAGCTAAGCTTAGGAAATTATGTTAA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Either start at the end of the gene or at the site of an internal stop codon (i.e. site 589). How is the isolate sequence different?
What has happened?
Whether you looked from the end of the gene or the site of an internal stop codon, you will notice that the isolate sequence is shifted one to the left. Tracing this upstream, you find it is due to the loss of an A at site 573, shown by the black arrow. This single base deletion has led to a frameshift.
What does this mean for a bacterium?
In a bacterium, the protein machinery would stop once it reaches a stop codon. This would be the first internal stop codon found at site 589. This produces a shorter protein that has different amino acids after the deletion site. We would need to do in vivo tests to confirm, but it is likely its function would be affected and possibly lost.
What would a curator do?
A curator would make a new allele noting that it has a deletion and frameshift.
