Puzzle 5 - Intermediate - Neisseria
Difficulty:
Today's isolate sequence is from Neisseria meningitidis.
Gene NEIS0514: Isolate 50842.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
We know something is different towards the end of the gene and there are additional stop codons. Focus on one of the internal stop codons, can you see why it's there? Zooniverse users identified a possible stop codon TAA at site 636 in the Zooniverse image. This will be site 586 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is NEIS0514. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGACAATAATGAATATCGATACTTCCGAAAATAAAGATGCTGTTGCCGAACACACCGGACAATGGTTGGAAAAAGCCGTCATCGGTCTGAACCTGTGTCCCTTTGCCAAAGCCCCCCCACGTTAAAAACCTTGTCCGCATCGCGATCAGCGAAGCCAAACACCTTGACGGTTTTTTGGAAGACTTGGACGAAGAACTGCAGCGACTGGGCAATACACCCGCCACCGAACTGGAAACCACCCTGCTGGTTCACCCGACCCTATTCCCCGATTTCGACGTATTCAACGATATGCTCGACATTGCCGATGCCGCCGTTGTCGAAAACGGCTTGGAAGGCATCGTCCAAATCGCCCCGTTTCATCCCTATTTCCAATTTGAAGGCACGGATTCAGACGGCATCGGCAACTACACCAACCGTTCTCCCTATCCGACGCTGCACCTCATCCGCGAAGACAGCATTGCCAAAGCCGCACAAGCCTTTCCCGACGCTTCGGCAATATTCGAACGCAATATCGCCCTGCTGGAAAAAATGGGACATGAAGGCTGGGCAAAACTCGGTATCACATCCTGCCCTTATCCGCACAATAAGAAAAATATTTCAAAATGA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Go to site 124 in MEGA. This is the first internal stop codon. Can you see why it occurred?
You could alternatively go to the proposed stop codon at site 586.
What has happened?
If you go to the first additional (also called internal) stop codon at site 124-126 (black box), you'll notice the sequence is shifted one to the right. The source of this can be traced back up to site 119 (black arrow) where there is an extra C base compared to the other alleles sequences. This is a single base insertion leading to a frameshift.
What does this mean for a bacterium?
In a bacterium, the protein machinery will stop once it reaches the first stop codon. This means the protein will be much shorter than usual. This is likely to stop it from functioning properly but in vivo tests would be required to confirm this.
What would a curator do?
A curator would create a new allele and note there is a insertion and frameshift.
