Puzzle 6 - Intermediate - Campylobacter
Difficulty:
Today's isolate sequence is from Campylobacter.
Gene CAMP0713: Isolate 79114.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
As there is not a stop codon highlighted in red, a change has occurred to the end of the gene. There are multiple additional stop codons. This indicates a big change.
The first additional stop codon is at site 102, 52 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is CAMP0713. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGAAAAAAATATTAATTTTTAAGTTTAGCAGCAGCAAGTTTTTTAAATGCTGAAATTTTAGTTTATGGTCCAGGTGGTCCCGCTCCTGTGCTAAAAGAGCTTGCTTTAAAATTTGAAGAAAAAACAAAAGAAAAGGTGATTGTAACCGCAGGTCCAACTCCAGCTTGGATAGACAAAGCAAAAGAAAATGCAGATTTGATTTTTTCAGGCAATACTTCAATGATGGATGATTTTGCTAAAAAAATTCCAAGTTTAAGTTTGGAAAATTTAAGCGTTTTAAATGTGCGTCCATCAGGTATTATCGTGCGTCCAAATAATCCAAAAAATATTAAAAATTTTGAAGACATTTTAAAAGATGGCATAAATGTTATGGTGGTTGATGGTGCAGGACAAGTTGGACTTTATGAAGATATGGCTTTAAAAAGTACAAAAAGAGAAAATTTGGTAAAATTACGTAAAAATATAAAAATTTATGCTAAAAATTCCAAAGCTGCTGTAGATGAGTGGAATAACAATCCAAATATTGATGCTTTAATCATTTGGTCTCATTGGGCAAAGGCTTTAGGCGATGATAAAGCTTTATTTATCAAAGATAAAAATGCAGTGATTTATCGTGCAGCTGAAATTGCTCCTACAAAAAAAGGTTTAGAAAATAAAAAAGCTTTAGAATTTGTAGATTTTATTAAGAGTAAGGAAGCTCAAAAAGTGTGGAAAAAATATACTTGGAAAGAAGTAAAATAA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Go to the site of the first additional stop codon (52-54). What do you notice about this in the isolate sequence compared to the allele sequences? Can you find where this change began?
What has happened?
The first additional stop codon is indicated below by the black rectangle. In this instance we need to focus on the alleles other than allele 1. When we do this, we notice that the isolate sequence is shifted one to the right. If we look upstream we find that there is an additional T base at site 21. This is a single base insertion and has led to a frameshift. Frameshifts often cause stop codons within the sequence (we identified as additional stop codons). We call these internal stop codons as they are within the gene.
What does this mean for a bacterium?
In a bacterium, the protein machinery would only go as far as the first stop codon, the one identified as bases site 52-54. This would lead to a very short protein. It would be unlikely for this to be functional. In vivo testing would be needed to investigate this.
What would a curator do?
A curator would create a new allele of the yellow highlighted region. They would note it has a frameshift and internal stop codons.
