Puzzle 7 - Intermediate - Acinetobacter
Difficulty:
Today's isolate sequence is from Acinetobacter baumannii.
Gene ACIN00725: Isolate 3063
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
Something is different towards the end of the gene. As there are internal stop codons, we would suspect a big change has happened (by this we mean an insertion or deletion, a small change would be a single base change etc). Zooniverse users identified a possible stop codon TAA at site 747 in the image, 697 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is ACIN00725. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGGAAAGTTGGCAAGAGGATTTATTATCAGCATTTTTGGTGGTAAAAAATGAATACCAGTTGTTTGAGATCGTTAAATCTACCGCATCAAGGCTCGGATTTGACTATTGCGCTTATGGTATGCAATCACCCTTATCTATTGCTGAACCAAAAACAATTATGTTGAATAATTATCCAGAAGCATGGCAGAAACGTTATGTGGAACGGCAATATGTGAAGATAGATCCAACTGTGCAGCATTGTATGGTATCACTTCAACCTCTTGTTTGGTCGAGTCAATCTGCAAAGACACAGGCAGAAAAAGATTTTTGGGAGGAAGCGCGTTCTTATGGTTTAAATGTCGGTTGGGCTCAGTCAAGCCGTGATTTTATTGGGACCCGAGGAATGCTAACACTGGCAAGATCCAACGACCAGTTATCAGAAAAAGAGCAAAAAGCACAATATACGAATATGTACTGGTTAACTCAAACAGTGCATCCAGCATTGCTAAAATAGTAAATGATGTAGAGTTTGCTAAATTCAATCTTTATTTAACGAACAGGGAAAAAGAGGCATTACGTTGGACTGCCGAAGGCAAAACGTCAGCAGAAATAGCTCAGATTCTTGGGGTAACTGAAAGAACCGTAAATTTCCATCTCAGTAACTCCATGCAAAAGTTAAATGTAAATAATAAAATTTCAGCAGCTATTCGAGCTGTAATGCTAGGGCTTTTGTAG |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Start at the end of the gene, can you notice what is different? Look upstream to see where this difference began.
What has happened?
If we look at the end of the gene, we can see that the isolate sequence is shifted one to the left in comparison to the defined alleles. If we scroll left, looking upstream, we find there is a base missing at site 478, shown below by the black arrow. This is a single base deletion that has led to a frameshift. This not only means that the stop codon at the end of the gene is out of frame, but internal stop codons are now present.
What does this mean for a bacterium?
In a bacterium, the protein machinery would stop once it reaches a stop codon, which would be an internal stop codon in this case. This would be site 543 in the Zooniverse image or 493 in the yellow highlighted sequence. This is just over half way through, so it is likely losing the rest of the protein would have disrupt its function. In vivo testing would determine this.
What would a curator do?
A curator would make a new allele with a note that it has a frameshift and internal stop codons.
