Puzzle 8 - Intermediate - Neisseria
Difficulty:
Today's isolate sequence is from Neisseria gonorrhoeae.
Gene NEIS2934: Isolate 50481.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
Something is different towards the end of the gene. Zooniverse users identified a possible stop codon at position 702 in the Zooniverse image, so 652 in the yellow highlighted sequence. This would be a good place to start.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is NEIS2934. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGAATTTGAAGGCTTTGATTGCGCGTTTCCGCGTGCTTGCCAATGATAAGGCCGAGCCGTATTTTTGGAGCGACGAAGAGGTGTCGGGATGGTTGAACGATGCGGTTCACGAGGCGTGCCTGCGCGGCCGGCTGCTGCATTCGGACGATGCGTTTGTAACGGATGTGGAAAAAGGGCGGCCGCTTTATGCTTATGCGGCATGGGGGTTTGCGGCGGGTTATGCGTATGAAATCGACAGTATCCGTTTTGTGTCCGACGGCAAGCCGGTGTGCCTGAAGTTGGTTTCGCCGGAGGCGGCGGATGTTTGCGCCCCGGGTTGGCGCGACGGGGCGCAAACGGGGCTGCCGGTTTATGCGGTGCAGGGCGACGGGAAGCTGACGCTTGCGCCTGCGCCGGACCGTGACGGCAGGTTGTTTGCCGGGGGTATTGCCTGCCGCGGGATATGGCGGGGGACGGGGACGAGCCGGAAATCAATTCCATACATCATCGGAATTTGGTTTATTGGGCTTTGGCGGAGGCTTTCAGTATCCCGGATGCGGAGACTTTCGACCCGCAGCGTTCGGAATCGGCAAGGAGGCGTTTCGAGCTGTATTTCGGCCTGCCGGCCGACAGTGATTTGCGCCGTATCACGCGTGAGGATGCGCCGCACCTGAACAGGCATTTTTGGATTTGA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Find the stop codon identified by the Zooniverse users at site 652-653. How does the isolate sequence differ from the alleles? Can you find the source?
What has happened?
If you go to site 652, you'll notice that the isolate sequence is shifted one to the left in comparison to the alleles. This has lead to the stop codon at 652 being in frame, and knocked the original stop codon out of frame. If you look further upstream you can find that a base has been lost around site 426, shown by the black box. This single base deletion has lead to the frameshift, changing the frame of the following sequence.
What does this mean for a bacterium?
In a bacterium, the protein machinery would stop as soon as it reaches a stop codon. This would be the one at site 652 which is not far from the end so the protein may be of a similar length. However, we need to consider how early in the gene the single base deletion occurred. If it was also around 650 then the protein would likely be functional but as the deletion and frameshift actually occurred around 200 bases earlier, leading to a different sequence of amino acids, it decreases the chance of a functional protein. The only way to determine this would be in vivo testing.
What would a curator do?
A curator would make a new allele and note it has a deletion and frameshift.
