Puzzle 9 - Intermediate - Neisseria
Difficulty:
Today's isolate sequence is from Neisseria meningitidis.
Gene NEIS0309: Isolate 50128.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
Something has changed towards the end of the gene. Zooniverse users found a possible stop codon at 229 (in the yellow highlighted sequence). There was also an internal stop codon. We should focus at the end, working our way into the gene.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is NEIS0309. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGAAGACATTAGAAAAACGGATGAAAGCTCTAGACAAACAGATGATGAAGTTCGGAAAATCCCTTGAAGGCAGGCTTGATGCCCGTCTGATTGAATCCGCATTGGATTATATTCATTATTCGGAACGTTTTTTTGGCTTTTGAAATCCTGTGTACTTATATCGAAGATTTCGATGTCCGGCTGACGGAACAAGAATCCCGGGAAATTTCTTTTATCAACAAGGAATTTGAGATAGAAAGCACGTCCGATTAA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Start at the end of the gene - do you notice anything different about the alignment of our isolate sequence? Can you find the source?
What has happened?
We find at the end of the gene that the isolate sequence is shifted one to the right. If we trace this upstream, we find it is due to an extra base (T) at site 135 (in the yellow highlighted sequence), shown by the black arrow. This is called a single base insertion which leads to a frameshift, knocking the following sequence out of frame.
What does this mean for a bacterium?
In a bacterium, the protein machinery continues until it reaches a stop codon. In this case it would go to site 229, the stop codon identified by Zooniverse users. This would create a shorter protein that also has different amino acids after the insertion. It is unlikely that this would be functional, but in vivo testing would need to be performed to confirm this.
What would a curator do?
A curator would create a new allele with the notes of insertion and frameshift.
