Puzzle 1 - Easy - Acinetobacter
Difficulty:
This isolate sequence is from Acinetobacter baumannii.
Gene ACIN10555: Isolate 2371.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
As the start and stop codon are highlighted, it would suggest that a small change has occurred within the sequence resulting in a stop codon.
Zooniverse users identified an additional stop codon in F3 at site 642 - TAA. This is site 592 in the highlighted yellow sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is ACIN10555. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGCATGATCCAGTCCTTGAGTCACATCATCTCGTATGTGAAAAACCCCAAACACGCCGCGGTATAGAACGTCGTTTAGCTCTATTGCTAAGCGCAACCGAGCTGTTTTTGGAAAAAGGATATGATGCTGTCTCTCTTGACGACATCGTCAATCATGCTGGTGGTTCAAAAACCTCTATTTATAAATACTTCGGTAATAAAGATGGCTTATTTACTGCAATCTGCGATTATCGCCGTGAAATGTTTTTTAAAGATATCTGCATTGCATTTCAACCAGAGCAAACTTCTTTAAAAGATTATTTAATCCAAACTCTCATCCGTTTTTATAAACACATTATTCAACCTGAACACATTGCCTTTTTACGTTTGGTTATTGAACAAACTCAATGTAATGCAACTTTGAGCCAATACTTATATGAAAAATGTGCTCTGGATGTCCAAAATACAATTGCTCAAGCCTTACTCATATCTCATCAATCAGGTGAAATTACCTGTACATCTCCTGATCATTCCTCTCTTATGTATTTTGGAATTTTACGTGATATTGAATGGCGAATGATTATGGGAATGCCTCTTCCACCCAATGAGACATAAGTTATTGATTATATTAACTATTGTGTTGATATTTTCTTAAAGGGCCATCATAAAGTCTAA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Focus around sites 592-594 as this is where the stop codon is in the sequence. Can you spot any changes compared to the other alleles?
What has happened?
Focusing in on the sequence at site 592, we find a T in our sequence compared to a G in the early alleles. This base would be referred to as highly conserved as it is seen in at this site in most of the sequences. This is shown below, with an black arrow indicating position 592.
We call this a point mutation. This point mutation has led to an internal stop codon, GAA encoded an amino acid but the new sequence TAA encodes a stop codon.
What does this mean for a bacterium?
In a bacterium the protein machinery would stop at the additional stop codon. This could lead to a protein that is functional or partially functional as the majority has been translated. We would only know conclusively from running tests in vivo.
What would a curator do?
A curator would create a new allele for this sequence with a note that it has an additional stop codon.
