Puzzle 2 - Easy - Campylobacter
Difficulty:
This isolate sequence is from Campylobacter.
Gene CAMP1443: Isolate 80415.
Can you solve the mystery of what’s happened?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
As the start and stop codon are in place, its likely only a small change has occurred in the gene it may be linked to the additional stop codon.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is CAMP1443. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGAGTATAAAAATCATTGAAGCGTCTATAAATTCAAGTTTACAAGACTTTGGTAGAAAAAAATTTGCTAAATTTGGCATAGCAAGAAGTGGGGCTATGGATGAAGATGCTTTAAGAATGGCAAATATCTTACTTGGAAACAAACAAGATGAAGCAGGAGTTGAACTTTGTTTAAAAGGTGGAAAATACGAATTTTTAGATGAGAATTATTTTGTTTTAAGTGGGGCTGAATTTGAGGCAAAGTTTAATAATCAAAAAATCAAAACTTATAAAGTATATAAAGCAAATAAAGGCGATATTTTAGAACTTGGTTTAGCAAAAATAGGTTTTCGTGGGTATTTATGCGTAGCGGGTGGCTTTGAAATAAAAAGCTTTTTAAACTCTAAATCCAGCGATGCTAAAATGGGAGTTGGATTTTTTGAAGGAAGAGCTTTGCAAAAAGATGATATTTTAAATACTCATAATACTTTTATACCTTTTAATTTAGAAGCTAGAGAATGTGAAAATCCCTTTTTTAAAAGTCCTAAAGAGCCTATTATACGCGTTATTTTAGGAACAAATGAAGATGCTTTTACCCAAAAAGGCATAGAAACTTTTTTAAATACTACTTATAAAGTGGGTTAAAAAAGCGATAGAATGGCAATTTATGCAGAATCTAGTGAAAGTATAGAGCATAAAAACTCAGCAGATATCATCTCAGATTCTGCGGTTTTTGGAAGTATACAAGTGCCAAAAAGTGGTATTCCTATTATTTTAATGGCAGCAAGACAAAGCACAGGAGGTTATACAAAAATAGCCACGGTTATAGAAAATGATCTAAGCTTACTTGCACAAGCTAAGTTAGGTTCTAGCTTTAAATTTCAAAGCATTAGTATGCAAGAAGCTTTAGAGCTTTATAAACAAAGAGAAATGAAATTTAAAATTATGGATCAAAAAATCAATCTTGATTTTGAAAATTTGATCTAA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Focus on the additional stop codon site - is there something different here? It's site 622-624 in the yellow highlighted sequence.
What has happened?
The images below show a portion of the sequences. The black box indicates the bases involved in the additional stop codon. There is an A in the isolate sequence at the second position in the place of a T (or C) in the other sequences. This is a point mutation. This has caused the codon to change from TTA in the other alleles to TAA in the isolate sequence. This is the sequence for a stop codon, we call this an internal stop codon.
What does this mean for a bacterium?
In a bacterium, the protein machinery would stop once it reaches the additional stop codon. This would produce a protein that is shorter than usual. To see if this is functional, we would do in vivo tests.
What would a curator do?
A curator would create a new allele of the yellow highlighted sequence, noting that it has an internal stop codon.
