Puzzle 3 - Easy - Neisseria
Difficulty:
This isolate sequence is from Neisseria meningitidis.
Gene NEIS0012: Isolate 50469
Can you solve the mystery of what’s happened?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
As the start and stop codon are highlighted, it's likely only a small change has occurred. Let's focus on the additional stop codon.
Zooniverse users found a stop codon at site 489 (TAA). This is site 439 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is NEIS0012. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGAGAAAATTCAATTTGACCGCATTGTCCGTGATGCTTGCCTTGGGTTTGACCGCGTGCCAGCCGCCGGAGGTGGAGAAAGCCGCGCCGGCCGCGTCCGGTGAGACCCAATCCGCCAACGAAGGCGGTTCGGTCGGTATCGCCGTCAACGACAATGCCTGCGAACCGATGAATCTGACCGTGCCGAGCGGACAGGTTGTGTTCAATATTAAAAACAACAGCGGCCGCAAGCTCGAATGGGAAATCCTGAAGGGCGTGATGGTGGTGGACGAACGCGAAAATATCGCCCCGGGGCTTTCCGACAAAATGACCGTAACCCTGCTGCCGGGCGAATACGAAATGACCTGCGGCCTTTTGACCAATCCGCGCGGCAAGCTGGTGGTAGCCGACAGCGGCTTTAAAGACACCGCCAACGAAGCGGATTTGGAAAAATTGTCCTAACCGCTCGCCGACTATAAAGCCTACGTTCAAGGCGAGGTTAAAGAGCTGGCGGCGAAAACCAAAACCTTTACCGAAGCCGTCAAAGCAGGCGACATTGAAAAGGCGAAATCCCTGTTTGCCGCCACCCGCGTCCATTACGAACGCATCGAACCGATTGCCGAGCTTTTCAGCGAACTCGACCCCGTCATCGATGCGCGTGAAGACGACTTCAAAGACGGCGCGAAAGATGCCGGGTTTACCGGCTTCCACCGTATCGAACACGCCCTTTGGGTGGAAAAAGACGTATCCGGCGTGAAGGAAACCGCGGCCAAACTGATGACCGATGTCGAAGCCCTGCAAAAAGAAATCGACGCATTGGCGTTCCCTCCGGGCAAGGTGGTCGGCGGCGCGTCCGAACTGATTGAAGAAGCGGCGGGCAGTAAAATCAGCGGCGAAGAAGACCGTTACAGCCACACCGATTTGAGCGACTTCCAAGCTAATGCGGACGGATCTAAAAAAATCGTCGATTTGTTCCGTCCGTTGATTGAGGCCAAAAACAAAGCCTTGTTGGAAAAAACCGATACCAACTTCAAACAGGTCAACGAAATTCTGGCGAAATACCGCACCAAAGACGGTTTTGAAACCTACGACAAGCTGAGCGAAGCCGACCGCAAAGCATTACAGGCTCCTATTAACGCGCTTGCCGAAGACCTTGCCCAACTTCGCGGCATACTCGGCTTGAAATAA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Focus in on the sequence of the internal stop codon (sites 439-441). Do you notice a difference in the sequence compared to the other alleles? What is the consequence?
What has happened?
If we focus on the site of the additional stop codon (site 439) we find a T in our isolate sequence. In our defined alleles (the ones we downloaded from pubMLST) there is a C in this position. This means that the isolate sequence codes for a stop codon (TAA) instead of an amino acid (CAA). This amino acid would have been glutamine.
The change from C to T at site 439 is indicated by the black arrow in the images below. This is a point mutation leading to an internal stop codon.
What does this mean for a bacterium?
In a bacterium the protein machinery would stop once it reaches the internal stop codon. As it is not far through the gene, the protein would unlikely be functional. In vivo testing could confirm this.
What would a curator do?
A curator would make an allele for the full yellow sequence and note it has internal stop codons.
