Puzzle 4 - Easy - Neisseria
Difficulty:
This isolate sequence is from Neisseria meningitidis.
Gene NEIS0362: Isolate 50102.
Can you solve the mystery of what’s happened?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
As the start and stop codons are in place it hints that only a small change has occurred in the isolate sequence. There is an additional stop codon (we call this an internal stop codon) at site 234, which is site 184 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is NEIS0362. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGAAAACCAATTCAGAAGAACTGACCGTATTTGTTCAAGTGGTGGAAAGCGGCAGCTTCAGCCGTGCGGCGGAGCAGTTGGCGATGGCAAATTCTGCCGTAAGCCGCATCGTCAAACGGCTGGAGGAAAAGTTGGGTGTGAACCTGCTCAACCGCACCACGCGGCAACTCAGTCTGACGGAATAAGGCGCGCAATATTTCCGCCGCGCGCAGAGAATCCTGCAAGAAATGGCAGCGGCGGAAACCGAAATGCTGGCAGTGCACGAAATACCGCAAGGCGTGTTGCGCGTGGATTCCGCGATGCCGATGGTGCTGCATCTGCTGGCGCCGCTGGCAACAAAATTCAACGAACGCTATCCGCATATCCGACTTTCGCTCGTTTCTTCCGAAGGCTATATCAATCTGATTGAACGCAAAGTCGATATTGCCTTACGGGCCGGAGAATTGGACGATTCCGGGCTGCGTGCACGCCATCTGTTTGACAGCCGCTTCCGCGTAATCGCCAGTCCTGAATACCTGGCAAAACACGGCACGCCGCAATCTACAGAAGAGCTTGCCGGCCACCAATGTTTAGGCTTCACCGAACCCGGTTCTCTAAATACATGGGCGGTTTTAGATGCGCAGGGAAATCCCTATAAGATTTCACCGCACTTTACCGCCAGCAGCGGTGAAATCTTACGCTCGTTGTGCCTTTCAGGTTGCGGTATTGCTTGCTTATCAGATTTTTTGGTTGACAACGACATCGCTGAAGGAAAGTTAATTCCCCTGCTCGCCGAACAAACCTCCGATAAAACACACCCCTTTAATGCTGTTTATTACAGCGATAAAGCCGTCAACCTCCGCTTGCGCGTATTTTTGGATTTTTTAGTGGAGGAACTGGGAAACAATCTCTGTGGATAA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Focus on the internal stop codon at site 184. How do the three bases in the isolate sequence 184-186 that make up this codon differ from the defined allele sequences?
What has happened?
If we focus on the internal stop codon at site 184-186, we find the first base at 184 is a T in our isolate sequence instead of a highly conserved G in the defined allele sequences, shown by the black arrow. Instead of coding GAA which is the amino acid glutamic acid, it codes TAA which is a stop codon. As it is in the middle of the sequence we call it an internal stop codon.
What does this mean for a bacterium?
The protein machinery in a bacterium would stop once it reaches a stop codon, which would be the internal stop codon in this case. The protein would be much shorter. This is likely to affect its function but in vivo testing would be required to confirm this.
What would a curator do?
A curator would make an allele, noting that it has an internal stop codon.
