Puzzle 5 - Easy - Campylobacter
Difficulty:
This isolate sequence is from Campylobacter.
Gene CAMP0531: Isolate 80465.
Can you solve the mystery of what’s happened?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
We need to focus on the internal stop codon as highlighted start and stop codons are in place. Zooniverse users identified the internal stop codon at site 99-101, 49-51 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is CAMP0531. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGAATTTAAAAGAGCAGATATTAAATGATATCAAAGAAGCGATGAAGTAAAAAGATGATTTTAAACGCGATACTTTAAGAACGCTAAATGCCGCGTTTAAACAGGTCGAAGTAGATGAAAGAATAGAGCTAAGTGATGAAAGAATTTTAAAAATTATCGCAAGCGAGATTAAAAAGCGCAAAGATGCTATCGAGCTTTATTCTAAAGGTGGAAGAGAGGATTTGGCACAAAAAGAACAAAAAGAAATAGCACTTTTTGAAAGTTATTTACCTCAGCAATTAAGCGATGAGGAATTGCAAGCAGCTTTAAAAGAAATGATTGCAAATTTAGGGGTTAGTTCTTTAAAAGATCAAGGTTTGGTGATGAAAGAAGCAAAGGCTAAATTTGGAGCAAGGGTGGATGGAAAAAGATTAAATGTAACACTTAGAGAGCTTTTAAATTAA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Focus on sites 49-51 in the yellow highlighted sequence. What is different compared to the defined alleles? What effect does this have?
What has happened?
If we go to sites 49-51, we notice that at site 49 there is a T in the isolate sequence but a C in the defined allele sequences, shown by the arrow. This is called a point mutation. This change to a T is significant as the codon no longer CAA, which coded for the amino acid glutamine, and is now TAA which codes for a stop codon. This introduces a stop codon into the gene sequence, we call this an internal stop codon.
What does this mean for a bacterium?
The bacterium's protein machinery would stop once it reaches this stop codon. This would lead to a shorter protein. As it is so early in the gene, it is unlikely that the protein would be functional. In vivo testing would be required to confirm this.
What would a curator do?
A curator would make a new allele, noting it has an internal stop codon.
