Puzzle 6 - Easy - Neisseria

Difficulty:

Image of three magnifying glasses, two faded out. Represents easy level.
detective bacteria

This isolate sequence is from Neisseria meningitidis.

Gene NEIS0394: Isolate 54238.

Can you solve the mystery of what’s happened?!? 

Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.  

Image of isolate 54238 DNA sequence (yellow) for gene NEIS0394. Amino acids for each of the three frames is shown above the sequence. There is a start codon highlighted in green. There is a stop codon highlighted red. There is an internal stop codon.
detective bacteria

What does this tell us?

As both the start and stop codon are highlighted, it's likely only a small change has occurred to create the additional stop codon at site 879, site 829 in the yellow highlighted sequence. 

 

Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.

1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is NEIS0394. If you struggle with this step, download here.

2. Open the defined alleles in MEGA - click here for the guide.

3. Copy the yellow highlighted sequence from below and paste it into MEGA.

Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.

ATGATAGACCTGCACTGCCATTCCACCGTTTCCGACGGTATGCTCTCTCCCGCCGAAGTCGTGCGCCTTGCGCATCAAAACGGCTGCACGCTGCTGGCGTTGACCGACCACGACCACACCGGCGGCATCGCCGAAGCGCGTGCCGAAGCAGACAGGCTCGGTTTGCGCCTGATTAACGGCGTGGAAATCTCCGTCACTTGGCGCGGACGCACCATACACGTTGTCGGTTTGGATTTCGACGAACGGGACGAAAACCTGCAAAACCTGTTGGCGCAAGTGCGGCAAGGCCGTCTGAAACGCCTCGAAGCCATCGCCGCCAAGCTGGAAAAACGCGGCATTTCGGGCGCATACGACGGCGCACTCGCGTTGGCGGCAAACAAAGAAATGGTCAGCCGCACACACGTCGCCGAGTTTCTCATTCGGGCGGGACACGTCAAAAACAAGCAGCAGGCGTTCATCAAATACTTGGGCGACGGCAAATCCTGCGCCGTCCGCCACGAATGGGCGACGCTGGAAGACTGCGTCTCCGCCGTCAACGGCGCGGGCGGCATGGCAGTCATCGCCCATCCGATGCGCTATGATTTGTCCGCTACCGCCAAGCGCAATCTGTTTGAAGAATTTAAAAACCTCGGCGGCGCGGGCATCGAAATCCACAGCGGCAACTGCTGCAAAAACGACCGCCTCAACTACGCATTTTTGGCAGAACGCTTCGGCATGCTCGCCAGTGCGGGCAGCGACTTCCACCGTTTAAACGACTTCAGCGGCGGCATCCTCGGCGCGTGTCCCGAACTGCCGGAAAACTGCAGGCCGGTGTGGGCGCATTTTTCCTGACATTGA 
detective bacteria

Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences? 

Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.

Check out the hint below if you get stuck.

 

 

 

Look at the site of the additional stop codon 829-831, can you notice any differences between the isolate sequence and the allele sequences?

What has happened?

If we focus in on the site of the additional stop codon, we see that there is a change from C to T in the isolate sequence. This is known as a point mutation. The change from a C to a T is significant as it results in a codon with the sequence TGA - a STOP CODON!! We call this an internal stop codon. 

Alleles and isolate sequence open in MEGA. Shown with colour. Isolate has point mutation creating an internal stop codon shown by a black arrow.
Alleles and isolate sequence open in MEGA. Shown without colour. Isolate has point mutation creating an internal stop codon shown by a black arrow.

What does this mean for a bacterium?

In a bacterium, the protein machinery would stop once it reaches this extra stop codon. As it is so close to the end of the gene, its possible that the protein would be functional/partially functional. In vivo studies would determine this.

What would a curator do?

A curator would make a new allele with the yellow highlighted sequence and note it has an internal stop codon.

How did you do?

If you didn’t quite get it this time – don’t worry! It’s all about practice 😊
Have a go at the next one! Click here for Puzzle 7.

Feel free to head over to the Zooniverse Genome Detectives forum and let us know how you did!