Puzzle 7 - Easy - Neisseria
Difficulty:
Today's isolate sequence is from Neisseria meningitidis.
Gene NEIS1956: Isolate 50101.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
There is not a stop codon highlighted in red so something is different at the end of the gene. As there are no additional stop codons it may only be a small change.
Zooniverse users identified a possible stop codon at site 576 (TGA). This would be site 526 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is NEIS1956. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
| ATGCCCCTGTTAGACAGTTTCAAAGTCGACCACACCCGTATGCACGCCCCTGCCGTACGCGTGGCGAAAACCATGACCACGCCCAAAGGCGATACCATTACCGTATTCGACCTGCGCTTTTGCGTTCCTAACAAAGAAATCCTGCCTGAAAAAGGCATACACACGCTGGAGCATTTGTTCGCAGGCTTTATGCGCGACCACTTGAACGGCAACGGCGTGGAAATCATCGACATTTCCCCGATGGGCTGCCGCACCGGTTTCTACATGAGCCTTATCGGCACGCCTTCCGAACAGCAGGTCGCCGATACGTGGCTGGCTTCGATGCAGGATGTTTTGAATGTCAAAGACCAAAGCAAAATCCCCGAGTTGAACGAATACCAATGCGGCACTTATCAAATGCACTCGCTCGCCGAAGCGCAGCAAATCGCGCAAAACGTGTTGGCGCGCAAAGTGGCGGTGAACAAAAATGAAGAGTTGACGCTGGATGAAGGGCTGCTGAACGCCCAA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Look at the end of the sequences - does anything differ in the isolate sequence compared to the defined sequence?
What has happened?
The image shows the end of the sequence. In our isolate sequence there is a C in the place of a T in the last three bases, which is the stop codon. This has led to an amino acid being encoded (glutamine) instead of a stop codon. We call this a point mutation.
What does this mean for a bacterium?
In a bacterium, the protein machinery would continue past the usual length as there is no stop codon. It would stop once it reached the stop codon identified by Zooniverse users. It is possible the protein could be functional with only a few extra amino acids, in vivo testing would be able to determine this.
What would a curator do?
A curator would create a new allele to the length of the stop codon found by Zooniverse users.
