Puzzle 1 - Intermediate - Campylobacter
Difficulty:
This isolate sequence is from Campylobacter.
Gene CAMP0061: Isolate 79118.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
There are additional stop codons within the gene and no highlighted stop codon, this implies something has happened within the gene.
Zooniverse users identified a possible stop codon at site 1035 (TGA) - which will be 985 in the yellow highlighted sequence. There are also additional stop codons, the first at site 783 which is 733 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is CAMP0061. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
| ATGAAAAAAAATATTGTTTTTTTCGAAGTTAAAGGTGGGAGTGATAAAGGTGAAGATGGTTATAGAAAAGATACTATGCCTATGGTAAATGCCTTAAAAGCTAAGGGTTGGAATGCTGAGGTGATTTTTTTTGAAGTGGGTAAAAAAGATGAAATTTACAAATATGTAAAAGAAAATTTTGATGGTTATGTTTCTCGCATCAATCCTGGCAATCTTAAAGAAGAAAATGAGTATTTTGATATGTTAAGAAAACTTTGTGCCGATAAGCTTGTAGGTATGCCTCATCCTGATGCTATGATAGGTTATGGTGCTAAAGATGCACTTACAAAATTAGCAGATACTGATCTTGTTCCAAGCGATACTTATGCTTACTATGATATTAAGACTTTTAAAGAAAATTTTCCAAAAAGTTTGGCTAAAGGTGAAAGGGTTTTAAAACAAAATCGTGGCTCTACAGGAGAGGGAATTTGGCGTGTGAGTGTAGAGGGTAATGTTAGTGGAGATAGTTTGCCTTTAAACACAAAAATCAAATGTACAGAAGCTAAGGATAATCATGTAGAACATAGAGAGCTTGGGGAATTTATGGATTTTTGCGAGCAATATATCATAGGTGATAATGGTATGCTTGTGGATATGACTTTTTTACCGCGCATTAAAGAAGGTGAAATCAGACTTTTAATGCTTTATAACACCCCTGTAAATGTAGTGCATAAAAAACCAGCCGAAGATGGCTGATGCTTTTTCTGCTACGCTTTTTAGTGGGGCAAAATATCGCTATGATAAGCCAGAAGATTGGAAAACTTTGGTGGATATGTTTTTAGGCGAGCTTCCTAAGGTAAGGGAAAAATTAGGCAATTACGACTTACCATTGATTTGGACGGCTGATTTTATTTTAGATACTGATGAAAAGGGCAATGATAAATATGTTTTAGGCGAGATTAATTGTTCTTGTGTAGGTTTTACTTCTCATTTAGAACTTGCTGATGAAGTAGCTTCAAATATTATTAATATTGTAAGTAAAACTAAGGCTTAG |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Take a look at the site of the first additional stop codon 733-735. Do you notice anything different about the isolate sequence compared to the define alleles? Can you tell where it has come from?
What has happened?
Start by looking at the site of the first additional stop codon, 733 (shown by the black arrow). You'll notice that the isolate sequence is shifted one to the right compared to the defined allele sequences. If you look further upstream, at site 731, you can see it is the addition of a extra G base that has caused this. We would call this a frameshift caused by a single base insertion.
What does this mean for a bacterium?
In a bacterium, the protein machinery would stop at the first stop codon it came across. This would be the additional stop codon we identified at site 733. As this is a most of the way through the sequence, there is a chance the protein produced could be partially functional. You would have to do in vivo testing to confirm this.
What would a curator do?
A curator would make a new allele sequence to the length of the sequence. They would note it has a frameshift and internal stop codon.
