Puzzle 2 - Intermediate - Acinetobacter
Difficulty:
Today's isolate sequence is from Acinetobacter baumannii.
Gene ACIN00725: Isolate 2696.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
Something has changed the end of the gene. As there are many additional stop codons it is likely something has affected the frame.
Zooniverse users identified multiple additional stop codons. The first at site 213, 163 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is ACIN00725. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
| ATGGAAAATTGGCAAGAAGATTTATTATCAGCATCATTGACTGTAAAAAGTGAATATCAGTTATTTGAGATCGTTAAGTCTACAGCTTTAAAGCTTGGATTTGAATATTGTGCTTATGGTATGCAATCACCCTTATCAATGCTGAACCAAAAACGATTATGTTGAATAATTATCCAGAAGCATGGCAGAAACGTTATGTGGAACGGCAATATGTGAAGATAGATCCAACTGTGCAGCATTGTATGGTATCACTTCAACCTCTTGTTTGGTCGAGTCAAACTGCAAAGATACCGACAGAAAAAGATTTTTGGGAGGAAGCGCGTTCTTATGGTTTAAATGTCGGTTGGGCTCAGTCAAGCCGTGATTTTATTGGGACCCGAGGAATGCTAACACTGGCAAGATCCAACGACCAATTATCAGAAAAAGAGCAAAAAGCACAATATACGAATATGTACTGGTTGACTCAAACAGTGCATTCCAGCATAGCTAAAGTAGTAAATGATGTAGAGTTTTCTAAATTCAATCTTTATTTAACGAACAGGGAAAAAGAGGCGCTACGTTGGACTGCAGAAGGCAAAACGTCAGCAGAAATAGCTCAGATTCTTGGTGTAACTGAAAGAACCGTAAATTTCCATCTCAGTAACTCCATGCAAAAGTTAAATGTAAATAATAAAATTTCAGCAGCTATTCGAGCTGTAATGCTAGGGCTTTTGTAG |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Start at the first additional stop codon, sites 163-165. How does the isolate sequence compare to the defined alleles? Can you find where the change started?
What has happened?
By looking at the sequence of the first additional stop codon at site 165 (shown by the black arrow) you may notice it is off by one to the sequences below. If you look further upstream (to the left) you'll be able to find the point a base has been lost - site 141. A single deletion of a T base has occurred, this has caused the subsequent codons to change. This is a frameshift caused by a single base deletion. The frameshift causes the multiple additional stop codons.
What does this mean for a bacterium?
In a bacteria, the protein machinery would continue until it reaches the first stop codon in the sequence. This would likely be an non-functional protein as it is much shorter that the full length. The way to conclusively tell this would be in vivo studies.
What would a curator do?
A curator would make a new allele to the length of the yellow highlighted sequence. They would note it has a frameshift and internal stop codons.
