Puzzle 4 - Hard - Campylobacter

Difficulty:

Image of three magnifying glasses. Represents hard level.
detective bacteria

This isolate sequence is from Campylobacter.

Gene CAMP0602: Isolate 80461.

Can you solve the mystery of what’s happened?!? 

Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.  

Image of isolate 80461 DNA sequence (yellow) for gene CAMP0602. Amino acids for each of the three frames is shown above the sequence. There is a start codon highlighted in green. There is not a stop codon highlighted red. There are internal stop codons.
detective bacteria

What does this tell us?

Something has changed towards the end of the gene as there is not a highlighted stop codon. If look in F3, we find there are multiple additional stop codons. This combination hints frameshift. 

Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.

1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is CAMP0602. If you struggle with this step, download here.

2. Open the defined alleles in MEGA - click here for the guide.

3. Copy the yellow highlighted sequence from below and paste it into MEGA.

Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.

ATGAAAAAATTTTATTGTATTTTTTAATATGTTTTAATTTTCTTTTTGCACAAATTAATACTCCTGAATTTTATGAAAGACAAATGAATGTTTTAAGAAATTTAGATATTAATCCAAGTTTTATCAGTGATTTGATTTTTGTGCAAACTCAACAAGATATAAAATCAAAACATGCTCAAACTTTAATAGATAGCATGCAAAATTTTTCAAAAGTTACTCCTATGATAAGAAAAATTTTAGCCCAGCAGGAAGTTCCTGATGAGATTTTGTATCTAGCTATGGTTGAATCAGGCTTGAAAACTCATAGCGTTTCTAATGCCAAGGCTGTAGGGGTTTGGCAATTTATGCAACCAACAGCTAGAAATTTGGGTTTAAGAATCGATGCTTATGTTGATGAAAGGCGTGATCCGGTCAAGTCAACTTATGCCGCTACAAATTATTTAAAAGAGTTAAAAGAAGAATTTGGCAAATGGTATTTAGCACTTTTAGCTTATAATTGCGGAAATGGCAAGCTAAGACAAGCTATCAAGCAAGCAGGAAGTGATGATTTAAGTGTTTTATTGAACCCTGATAAGAAATATCTTTCTTTAGAAACTAGAAATTTTATAAGAAAGATTTTAACGCTTGCTTTTTTAGCTAATGATAGGGATTTTTTGCTAGATAAAGATGCGTCTTTAATGAATTATGCTTTAAGCAATGAATTTGCAAAAGTTGATGTGCCTTCTTCTGCATCTTTAAAAGAAATAGCTAAAAATTTAAATATGGATCTTGCAACTTTTAAGAAATATAATCCACAATTTAAACATAATTTTACGCCTCCTGGTAAAGGGTATTATATGTATATACCACTTAATAAAGTAGCATTTTTTGATAAAAATTTTAAAGCAGAAAAACTTGCAAAGGTTGATACAACTATACCTATGACAAGAACTTATACCGTTAAGTCTGGTGACTCTTTATATAAAATAGCAAAAAATTATAATATAAGTGTTGATGAAATTCGAGAATTCAATAAAATAGCAAAAAATCATCTTAGTATTAATCAAAAATTAATTATACCAATCAAGGAGAATAAAAATGCAAATAAAAACAATTACACTAAAGTTGTCAGCCGTTAG
detective bacteria

Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences? 

Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.

Check out the hint below if you get stuck.

 

 

 

Start at the end of the gene or the site of an internal stop codon (remember take 50 off the position in the image as the sequence given above only has the yellow region). How is the isolate sequence different? Can you find the cause? 

What has happened?

We find that the isolate sequence is shifted one to the left in comparison to the defined alleles. We trace this all the way back to site 10 in the yellow highlighted sequence, shown by the arrow. Here a single base deletion has occurred as an A base has been lost. This has led to a frameshift so the rest of the gene is out of frame. There are lots of internal stop codons as the frameshift occurred early on in the gene. 

Alleles and isolate sequence open in MEGA. Shown with colour. Arrow points to site 10 where a base has been lost in the isolate sequence compared to the defined alleles.
Alleles and isolate sequence open in MEGA. Shown without colour. Arrow points to site 10 where a base has been lost in the isolate sequence compared to the defined alleles.

What does this mean for a bacterium?

The bacterium's protein machinery would stop as soon as it reaches the first stop codon. This would be at site 25. The protein would only be 8 amino acids long (MKKFYCIF) as seen in the images below, where a * represents a stop codon. It is extremely unlikely this protein would function, in vivo testing would be needed to confirm this.

Isolate and defined amino acids sequences open in MEGA with colour. Stop codon indicated by a *. Letters represent amino acids.
Isolate and defined amino acids sequences open in MEGA without colour. Stop codon indicated by a *. Letters represent amino acids.

What would a curator do?

A curator would make a new allele, noting it has a deletion and frameshift.

How did you do?

If you didn’t quite get it this time – don’t worry! It’s all about practice 😊
Have a go at the next one! Click here for Puzzle 5.

Feel free to head over to the Zooniverse Genome Detectives forum and let us know how you did.