Puzzle 5 - Hard - Acinetobacter

Difficulty:

Image of three magnifying glasses. Represents hard level.
detective bacteria

This isolate sequence is from Acinetobacter baumannii.

Gene ACIN12090: Isolate 2661.

Can you solve the mystery of what’s happened?!? 

Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.  

Image of isolate 2661 DNA sequence (yellow) for gene ACIN12090. Amino acids for each of the three frames is shown above the sequence. There is a start codon highlighted in green. There is not a stop codon highlighted red.
detective bacteria

What does this tell us?

As there is no stop codon something has gone wrong towards the end of the gene. Zooniverse users identified a possible stop codon at site 579, this is site 529 in the yellow highlighted region.

Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.

1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is ACIN12090. If you struggle with this step, download here.

2. Open the defined alleles in MEGA - click here for the guide.

3. Copy the yellow highlighted sequence from below and paste it into MEGA.

Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.

ATGAAAAACATTCAGAAATCACTTCTTGCAGCATTAATAGTTGCTGGTTATGCGGTAAATACTCAAGCAGCTGTTACTGGTCAGGTTGACGTTAAATTAAATATCTCAACAGGCTGTACTGTAGGTGGTAGTCAAACTGAAGGAAATATGAACAAGTTTGGTACTTTAGATTTTGGTAAAACTTCCGGTACTTGGAACAACGTATTAACAGCTGAAGTTGCTTCAGCGGCAACAGGTGGCAATATTTCTGTGACTTGTGACGGAACAGATCCTGTTGATTTTACAGTCGCAATTGACGGTGGTGAACGTACAGACCGCACTTTAAAAAATACTGCTTCTGCTGATGTAGTTGCATATAACGTTTATCGCGATGCTGCACGTACAAACCTATATGTTGTAAACCAACCACAACAGTTCACTACAGTAAGTGGCCAAGCTACTGCTGTACCAATTTTCGGTGCAATTGCTCCAAACACAGGTACACCAAAAGCACAAGGCGATGGCTTTGTTGCACAAAGATTTAAAAGATAACACTCT 
detective bacteria

Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences? 

Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.

Check out the hint below if you get stuck.

 

 

 

Focus on the end of the sequence. Does the isolate sequence look like the allele sequences? 

What has happened?

Focusing at the end of the gene, we see the isolate sequence varies significantly from the defined alleles. This begins at site 502 in the yellow highlighted sequence, shown by the black arrow in the images below. This is caused by a large insertion or deletion leading to a big change in sequence. 

Alleles and isolate sequence open in MEGA. Shown with colour. Black arrow indicates where a large insertion or deletion has occurred. The end of the isolate sequence is very different to the defined alleles.
Alleles and isolate sequence open in MEGA. Shown without colour. Black arrow indicates where a large insertion or deletion has occurred. The end of the isolate sequence is very different to the defined alleles.

What does this mean for a bacterium?

In a bacterium, the protein machinery continues until it reaches a stop codon. This would be the stop codon identified by Zooniverse users at site 529. Here the protein would terminate. This would be a protein of very similar length however the final bases would be different. To determine if this would alter it's function we would need to do in vivo testing. 

What would a curator do?

A curator would create a new allele. 

How did you do?

If you didn’t quite get it this time – don’t worry! It’s all about practice 😊
Have a go at the next one! Click here for Puzzle 6.

Feel free to head over to the Zooniverse Genome Detectives forum and let us know how you did.