Puzzle 6 - Hard - Neisseria

Difficulty:

Image of three magnifying glasses. Represents hard level.
detective bacteria

This isolate sequence is from Neisseria meningitidis.

Gene NEIS1927: Isolate 51107.

Can you solve the mystery of what’s happened?!? 

Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.  

Image of isolate 51107 DNA sequence (yellow) for gene NEIS1927. Amino acids for each of the three frames is shown above the sequence. There is a start codon highlighted in green. There not a stop codon highlighted red.
detective bacteria

What does this tell us?

We need to focus on the end of the gene as the start codon is in place. 

Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.

1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is NEIS1927. If you struggle with this step, download here.

2. Open the defined alleles in MEGA - click here for the guide.

3. Copy the yellow highlighted sequence from below and paste it into MEGA.

Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.

ATGTTTTATGATTCAAAATGTTGTTACTTCAATAATCCTGTATTCTGGGACAGCCGTAGACTTACTTACTTACTTATCCTAATGTTATTTTTTGCCAAAAAAAAAGCAGAAAAGACATCATTAACATCTATTTAGGACAATTTCTAGGCTCTGTTAGCCTGATATTGCTAAGTTTGCTTTTTGCATTTGTCTTAGATTATATTCCTAGTAAAGAGATTTTAGGTTTGCTCGGCTTGATTCCGATTTTCCTAGGCCTCAAAGTTTTGCTGTTAGGAGATTCCGATGGAGAGTCTATTGCCAAAGAGGGTTTGCGCAAAGATAATAAAAACCTGATTTTTCTAGTCGCTATGATTACTTTTGCAAGTTGTGGCGCTGACAATATTGGTGTCTTTGTCCCATATTTTACTACCTTAAATTTAGCGAATTTGATAGTGGCTTTACTTACCTTTCTAGTTATGATTTATCTCTTGGTTTTTTCTGCCCAAAAATTGGCACAAGTCCCTTCTGTCGGAGAAACTTTGGAAAAATATAGCAGATGGTTTGTTGCCGTTGTTTATTTAGGATTGGGGATATATATCCTGATTGAAAACAACAGTTTTGATATGCTATGGACTGTGTCGGGCCAGGAAAAAATATTATGA
detective bacteria

Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences? 

We usually say to focus on the top 10 alleles, in this case however, the start looks different to the top 10, similar start sequences can be found further down. Remember - the start codon was highlighted so we are happy with the start of the gene, it is the end of the gene we wanted to focus on.

Check out the hint below if you get stuck.

 

 

 

It may help to drag allele 341 to the top as this has the same start sequence to our sequence. Our isolate sequence does match up 74 bases into the gene. What happens after this point that leads to no highlighted stop codon?

You may also want to have a think about what the change means for a bacteria creating this protein?

What has happened?

There has been a single base deletion at site 101, shown by the arrow below. This has led to a frameshift. The original stop codon is now out of frame. Allele 341 has been moved up to position 9 to show its similarity with the isolate sequence.

Alleles and isolate sequence open in MEGA. Shown with colour. Isolate sequence shifted one to the left, a frameshift has occurred due to the loss of one base.
Alleles and isolate sequence open in MEGA. Shown without colour. Isolate sequence shifted one to the left, a frameshift has occurred due to the loss of one base.

What does this mean for a bacterium?

This frameshift has led to multiple internal stop codons. As the first internal stop codon is at position 183, if a bacterium made this protein it would be much shorter and unlikely to perform it's function. In vivo testing would be required to confirm this. 

What would a curator do?

A curator would make a new allele, noting that it has a deletion.

How did you do?

If you didn’t quite get it this time – don’t worry! It’s all about practice 😊
Head back to the main page to see what's next!

Feel free to head over to the Zooniverse Genome Detectives forum and let us know how you did!