Puzzle 1 - Hard - Acinetobacter
Difficulty:
This isolate sequence is from Acinetobacter baumannii.
Gene ACIN10555: Isolate 7439.
Can you solve the mystery of what’s happened?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
From this we know something is different at the end of the gene. As there are no additional stop codons, it may be only a small change.
Zooniverse users identified a possible stop codon at site 705, site 655 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is ACIN10555. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGCATGATCCAGTCCTTGAGTCACATCATCTCGTATGTGAAAAACCCCAAACACGCCGCGGTATAGAACGTCGTTTAGCTCTATTGCTAAGCGCAACCGAGCTGTTTTTGGAAAAAGGATATGATGCTGTCTCTCTTGACGACATCGTCAATCATGCTGGTGGTTCAAAAACCTCTATTTATAAATACTTCGGTAATAAAGATGGCTTATTTACTGCAATCTGCGATTATCGCCGTGAAATGTTTTTTAAAGATATCTGCATTGCATTTCAACCAGAGCAAACTTCTTTAAAAGATTATTTAATCCAAACTCTCATCCGTTTTTATAAACACATTATTCAACCTGAACACATTGCCTTTTTACGTTTGGTTATTGAACAAACTCAATGTAATGCAACTTTGAGCCAATACTTATATGAAAAATGTGCTCTGGATGTCCAAAATACAATTGCTCAAGCCTTACTCATATCTCATCAATCAGGTGAAATTACCTGTACATCTCCTGATCATTCCTCTCTTATGTATTTTGGAATTTTACGTGATATTGAATGGCGAATGATTATGGGAATGCCTCTTCCACCCAATGAGACAGAAGTTATTGATTATATTAACTATTGTGTTGATATTTTCTTCTCTGTACACGATAAAAATAGA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Focus towards the end of the gene. Does the isolate sequence look like the defined allele sequences? Or is it very different?
What has happened?
The event that has occurred is a large deletion OR insertion. We think this as the bases at the end of the sequence do not match any of the defined alleles. This is shown in the image below focussing on the end of the sequence. The change began at site 633, shown by the black arrow.
By translating the sequence (converting it into amino acids) we can see the changes in amino acids, indicated by the black rectangle.
Without looking at the rest of the sequence, we cannot tell whether it is a deletion or insertion. If it is an insertion, we would expect to find the "missing" sequence further downstream. If it is a large deletion, we would not expect to find the "missing" sequence.
For example:
Starting sequence: ATGGGGGAAAATTTTTGGGGGTGATTTTAC
Insertion example: ATGGGGGAAAATTTTTGGTTCAAAAAGTGGGTGATTTTAC
Deletion example: ATGGGGGAAAATTTTTGGTTTTAC
What does this mean for a bacterium?
In a bacterium, the protein machinery would continue until it reaches a stop codon. This would be the one identified by Zooniverse users. In vivo testing would be needed to see if the changes in amino acid effect the protein's function.
What would a curator do?
A curator would look into this in more detail. They would explore the surrounding sequence to see whether they can identify where the missing sequence is.
