Puzzle 3 - Hard - Acinetobacter
Difficulty:
This isolate sequence is from Acinetobacter baumannii.
Gene ACIN00715: Isolate 2667.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
From this we know something is different at the beginning of the gene. There is not a start codon in the same frame as the highlighted stop codon and there are internal stop codons within. This would hint that there has been an insertion or deletion.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is ACIN00715. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
GGCCTTGGTGCAGTAAATAGACACCGTCTACAGGCAAGCCAATATCAGCCGCCACTTGTTCTTTAACTTGAGTTCTGATGGTTTCAAAATTAAGTGTCGGAGTTGAACTGTCCAAACAATGAAGAACTAGATCAATTTGATAAAGTCGATACAGCTTATGTCGTGGCTCAAGACAGAGAATCCAATATCATTGGTTGTGCCAGACTACTACCCACCACACAACCTTATTTACTCGGGGAAATATTTCCCCAACTTCTCAATGGAATGCCTACTCCCTGCTCACCAGAAATTTGGGAATTATCAAGTTTTTCAGCCGTAGATTTTTCAAATCCGCCTTCCTCTAGCAGTCAGGCTGTGTCATCACCTGTCTCAATTGCAATTCTGCAAGAAGCAATCAACTTTGCAAGAGAACAAGGCGCAAAACAACTCATTACGACTTCTCCTCTTGGAGTAGAACGTTTATTACGTGCTGCGGGTTTTCGTGCCCATCGTGCAGGTCCACCAATGACGATTGATGGATATTCGATGTTTGCATGCTTGATTGATATCTAA |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
See if you can find a section where the isolate sequence is similar to the allele sequences. Can you find where it changes? How different is it?
What has happened?
As shown in the images below, a massive change has occurred at the start of the sequence. It isn't until position 99 in the yellow highlighted sequence that the isolate sequence matches the alleles (shown by the black arrow). This is an large insertion or deletion which has lead to the sequence being completely different. We cannot tell which without looking at more of the upstream region which is what a curator would investigate next.
What does this mean for a bacterium?
This is quite different to ones we've looked at previously. As there is no start codon in the frame, the protein will not be produced in the expected way.
What would a curator do?
A curator would investigate further to see if they can identify if it is an insertion or deletion (mentioned earlier, more information here.) They would then decide whether or not to create an allele.
