Example B
Difficulty:
Today's isolate sequence is from Campylobacter.
Gene CAMP1518: Isolate 79117.
Can you solve the mystery of what’s happened?!?
Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers.
What does this tell us?
The start and stop codons are highlighted, indicating only a small change has occurred, this could be linked to an additional stop codon present.
Zooniverse users identified the additional stop codon at position 69 (TAA). This would be site 19 in the yellow highlighted sequence.
Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.
1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is CAMP1518. If you struggle with this step, download here.
2. Open the defined alleles in MEGA - click here for the guide.
3. Copy the yellow highlighted sequence from below and paste it into MEGA.
Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.
ATGTCAAATTTTAAAATATAAGGTAGGCAAATGAAAGAATTTTATATGAATTTAGCTTTAAATGAGGCTTGGAAATATCAGTTTTTAACCTATCCAAATCCGGCTGTAGGCTGTGTAATCTTAGATAAAAATGAAAAAATTTTAGCCATAAAAGCTCATGAAAAAGCTGGATTAGCTCATGCGGAACTTAATGCCATAGCTCATGCTTTTAAAAGCTTAAGACCTGAAATTTCATTGCCTAAAGAAGCAAACGCCTTGCATGAGTTTATTTGCAAAAACCATCAAGGTGTATTTAAAGATAGCATAGCTTTTGTCACACTTGAGCCTTGCTCTCATCAAGGAAAAACGCCTCCTTGTGCAAAACTCTTTAGCGAGCTAGGTTTTAAAAAAATTTTCATCAGCGTTAAAGATGGAAATAAAATCGCAAGTGGTGGGGCTGAATTTTTAAAAAAACAAGGCATAGAGGTTGAATTTGACATACTTAAAGAAGAAGGAAAAAAACTTTTAAAACCTTTTTTAAAATGGCAAAAAGGGCAATTTAAACTTTTTAAATTAGCCCTTTCTATGAATGGCTCGCCTTTTGGCAAAATCGTAAGCAATGAGCTAAGTCGCACTTATGCACATGAAATTAGAGCGGTGATTGATTTGCTTGTAGTCGGTGGAGAAACCATAAGAAAAGATTGCCCTATATTAGATGCTAGGCTTTGCAAAGCAAAAGCGCCTAATCTTTGTATCTTAAGCCGTCAAAATATAGATAATTTTGATAAAAATATCCCTTTATTTAAAGTTCCAAACCGCCAAATTTATACCCAAATTCCAAGTGAAGCTAAATTTTTAATGTATGAGGGTGGAGAAAATTTTCTCAAAACCTTTAAAGATGAAATAGATATGTTTTTGATTTTCCAAAGTTCAAGTTTAAATGATGAAAAAAATGTTACAATACCTTTAAATTTCAAGCCACTTTATAGGAATTTTTTAGGGAGTGATACTTATGGCATTTATGAACTTTAG |
Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences?
Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.
Check out the hint below if you get stuck.
Look at the area surrounding the additional stop codon!
Remember that every three bases encodes one amino acid (or a stop codon).
What has happened?
If we focus on the bases of the additional stop codon, we can see it's sequence varies with a T compared to the defined allele sequences (the ones we downloaded) which has a C. This leads to a stop codon being coded for instead of an amino acid (glutamine). We call this an internal stop codon. This base change is shown with the black arrow indicating position 19.
You may have spotted that sequence 4 has a T in position 19. If you look at the rest of the sequence you can see it looks different to the others. This is expected in the files. The surrounding sequence to the T does not lead to a stop codon. You can check this using the "Translated Protein Sequences" tab.
What does this mean for a bacterium?
In a bacterium, the protein machinery would stop once it reached the additional stop codon. The protein is not likely to be functional as it is so short, in vivo testing would be required to confirm this.
What would a curator do?
A curator would create an allele, noting it has an internal stop codon.
