Example A

Walkthrough:

Example A Walkthrough

https://www.youtube.com/embed/8lXEv51QlYg?wmode=opaque&controls=&rel=0

 

Difficulty:

Image of three magnifying glasses, two faded out. Represents easy level.
detective bacteria

Today's isolate sequence is from Campylobacter.

Gene CAMP0021: Isolate 80811.

Can you solve the mystery of what’s happened?!? 

Let's start by looking at the image presented on Zooniverse. Use the section on the right to check your answers. 

Image of isolate 80811 DNA sequence (yellow) for gene CAMP2021. Amino acids for each of the three frames is shown above the sequence. There is a start codon highlighted in green. There is not a stop codon highlighted red.
detective bacteria

What does this tell us?

As the stop codon is not highlighted we know something has happened near the end of the gene.

Zooniverse users identified a possible stop codon at site 972 in the image. This is site 922 in the yellow highlighted sequence.

 

 

Next we need to compare our isolate sequence (the yellow highlighted sequence in the Zooniverse image) to defined allele sequences of the gene.

1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is CAMP0021. If you struggle with this step, download here.

2. Open the defined alleles in MEGA - click here for the guide.

3. Copy the yellow highlighted sequence from below and paste it into MEGA.

Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.

ATGAAATTTGTTAATTTTATACAGGGTCAAAAACCCAATCTAGGAGTACTAAATTCTAGTGGAAAAATTGTAAGTTTTGATGATCTTGGCATTGAAACTAACGATATGAATGAATTTATTATCCATTTTGATAAATTTAAACACAAACTTACAGACTTGGATTCTAAAATAGCCTATGAAATTCCACAAGAAAATTATCTAGCCCCTATTATAGAACCTCGTCAAGATATTATATGTCTTGGGATTAATTTTTTAGATCATGCCAAAGAATCTGCCAAATTTAAGGGTGAAAAATTTGAAGAAAGAGAATATCCTGTATATTTTGGAAAACGTTGCAATCAAGCTACGCCACCTTTTGGCGATATACCTTTACATGCAGATGTAACTTCTCAGCTTGATTATGAATGTGAGCTTGCATTTATTTTAAGTAAAGATGCTTATAAAATCAAAGCTAAAGATGCAAAAGATTATATCTTTGGCTATACTATTATCAATGAAATTTCAGCTCGCGAACTTCAAAAACGCCACAAACAATTCTACCGAGCAAAAAGTCTTGAAGGTAGCACTATAATGGGACCTTATATCACAAGCGTAGATGAAATTTCTTATCCTCCTAAACTCCAACTTCAAAGCTATGTCAATGATGAACTACGCCAAAACTCTAACACTCAATTGTTTATTTTTGATATTGCTTATGTCTTAGAAGAACTTAGTGCAGGCATGCTTTTAAAAGCTGGAAGTATTATATCTATGGGAACTCCTAGTGGAGTAGGTATGGGGTTAAATCCACCTACTTTTTTAAAATCAGGAGATAAAGTACGTTGCGTTATAGAAAATTTAGGAGAACTTTGTAATAAAATAAAAAATATCAATATATTAA
detective bacteria

Scroll across and you’ll see how the sequences vary. Can you spot how it varies from the allele sequences? 

Focus on the top 10 alleles. The alleles further down have more variation, we don't want to focus on these. Some alleles will have internal stop codons - this can be a bacterium's way of turning off a gene.

Check out the hint below if you get stuck.

 

 

Focus at the end of the gene – this area was identified by Zooniverse!

What has happened?

If we focus on the end of the gene, the isolate sequence appears to be "sticking out" in comparison to the other alleles (the sequences we downloaded from PubMLST). If you look carefully, you can see this is due to the addition of an "A" base shown by the arrow.

Alleles and isolate sequence open in MEGA. Shown with colour. Isolate sequence shifted one to the right, a frameshift has occurred due to the insertion of one base.
Alleles and isolate sequence open in MEGA. Shown without colour. Isolate sequence shifted one to the right, a frameshift has occurred due to the insertion of one base.

This has led to a frameshift. So the original stop codon is now out of frame. 

What does this mean for a bacterium?

In a bacterium, the protein machinery would continue until it reaches the stop codon identified by Zooniverse users. This would mean a longer protein is made. This could be possible if the extra amino acids don't affect how the protein folds. In vivo studies would need to be run to test this. 

What would a curator do?

A curator would create a new allele that goes up to the identified stop codon.